Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0071896 | |||
Gene | TRIO | Organism | Human |
Genome Locus | chr5:14286979-14378236:+ | Build | hg19 |
Disease | Facet joint Osteoarthritis | ICD-10 | Polyarthrosis, unspecified (M15.9) |
DBLink | Link to database | PMID | 29470979 |
Experimental Method | |||
Sample Type | Facet joint Tissues | Comparison | 10 vertebral fracture patients as control with 48 Facet joint Osteoarthritis (FjOA) patients with lumbar surgery |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTTTGAGAGGAGTGCCAAGC ReverseAGAAGGGGCTTGATGGAGTC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Chu, C, Chunshuai, W, Jiajia, C, Jinlong, Z, Pengfei, X, Jiawei, J, Zhiming, C (2018). Transcriptional information revealed differentially expressed circular RNAs in facet joint osteoarthritis. Biochem. Biophys. Res. Commun., 497, 2:790-796. |